You are 2874898 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1AW4 1AW4 A7DNANMR1997-10-09



models:   1   2   3   4   5   6   7

 model 1, 2, 3, 4, 5, 6, 7 
>strand_A
accugggggaguauugcggaggaagguaa
((((......((...))......))))..