You are 2873612 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1BIV 1BIV A5VIRAL PROTEIN/RNANMR1996-06-12



models:   1   2   3   4   5

 model 1, 5 
>strand_A
GGCUCGUGUAGCUCAUUAGCUCCGAGCC
.(((((.(.((((....)))))))))).
 model 2, 3, 4 
>strand_A
GGCUCGUGUAGCUCAUUAGCUCCGAGCC
((((((.(.((((....)))))))))))