You are 2849547 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1BR3 UH0001 A, B1DNA/RNA HYBRIDX-Ray Difraction31998-08-13


model 1
>strand_A
gGACAGAUGGGAG
((((((.......
>strand_B
gcucccaggcuagcuacaacgacugucc
..............(......)))))))