You are 2829333 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1D4R AR0024 A, B, C1RNAX-Ray Difraction21999-10-05


model 1
>strand_A
gGUGACCUCCCGGGAGCGGGGGACCACUa
((((..((((((....((((((..((((.
>strand_B
gGUGACCUCCCGGGAGCGGGGGACCACU
))))..))))))....))))))..))))
>strand_C
GUGACCUCCCGGGAGCGGGGGACCACU
...........................