You are 2873611 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1DDY UR0008 A, C, E, G1RNAX-Ray Difraction31999-11-12


model 1
>strand_A
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>strand_C
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>strand_E
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>strand_G
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..