You are 2895921 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1FOQ A, B, C, D, E1RNAElectron Microscopy202000-08-28


model 1
>strand_A
uCAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAACCCUGAUUGAGUUCAGCCCACAUACUUUGUUGAUUGGUUGUCAAUCAUGGCAAAAGUGCACGCUACUUUGAUAA
((((-((((((((((((---(((.(((..((((((-(((........[((((..-...)))))))))))))...((((((..<..)))))).))).)))))))))-))-))))))))---
>strand_B
UCAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAACCCUGAUUGAGUUCAGCCCACAUACUUUGUUGAUUGGUUGUCAAUCAUGGCAAAAGUGCACGCUACUUUGAUAA
((((-((((((((((((---(((.(((..((((((-(((.....{{..((((..-...)))))))))))))...((((((.]...)))))).))).)))))))))-))-))))))))---
>strand_C
UCAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAACCCUGAUUGAGUUCAGCCCACAUACUUUGUUGAUUGGUUGUCAAUCAUGGCAAAAGUGCACGCUACUUUGAUAA
((((-((((((((((((---(((.(((..((((((-(((......[[[((((..-...)))))))))))))...((((((...}})))))).))).)))))))))-))-))))))))---
>strand_D
UCAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAACCCUGAUUGAGUUCAGCCCACAUACUUUGUUGAUUGGUUGUCAAUCAUGGCAAAAGUGCACGCUACUUUGAUAA
((((-((((((((((((---(((.(((..((((((-(((.....{.{.((((..-...)))))))))))))...((((((.]]].)))))).))).)))))))))-))-))))))))---
>strand_E
UCAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAACCCUGAUUGAGUUCAGCCCACAUACUUUGUUGAUUGGUUGUCAAUCAUGGCAAAAGUGCACGCUACUUUGAUAA
((((-((((((((((((---(((.(((..((((((-(((.......>.((((..-...)))))))))))))...((((((..}.})))))).))).)))))))))-))-))))))))---