You are 2829334 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1FQZ 1FQZ A1RNANMR2000-09-07


model 1
>strand_A
GCCGAGUAGUGUUGGGUCGCGAAAGGC
(((.....(((......)))....)))