You are 4700898 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1EFA PD0118 D, E1TRANSCRIPTION/DNAX-Ray Difraction2.62000-02-07


model 1
>strand_D
gaauugugagcgcucacaauu
----((((((((((((((...
>strand_E
gaauugugagcgcucacaauu
-...))))))))))))))---