You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1LB2 PD0306 K, J1GENE REGULATION/DNAX-Ray Difraction3.12002-04-01


model 1
>strand_K
cuuuuuuccuaaaaugugau
(((((((((((((((((((.
>strand_J
cuagaucacauuuuaggaaaaaag
.....)))))))))))))))))))