You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1NH3 PD0370 B, C, D1ISOMERASE/DNAX-Ray Difraction3.12002-12-18


model 1
>strand_B
aaaaagacuu
((((((((((
>strand_C
ggaaaaauuuuu
(((((((.(.(.
>strand_D
aaaaauuuuuccaagucuuuuu
.).).)))))))))))))))))