You are 4700902 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1S03 PR0111 A, B1TRANSCRIPTION/RNAX-Ray Difraction2.72003-12-29


model 1
>strand_A
GGACGAUGGCGAAACUGCAUGAGGCAAUUCAUGCAAGUCCCUCGUCC
((((((.((.((..((((((((......)))))).))))))))))))
>strand_B
GGACGAUGGCGAAACUGCAUGAGGCAAUUCAUGCAAGUCCCUCGUCC
((((((.((.((..((((((((......)))))).))))))))))))