You are 4700899 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1S76 PH0009 T, N, R1TRANSFERASEX-Ray Difraction2.882004-01-29


model 1
>strand_T
gccgugcgcauucgccguguu
[.........(((((((....
>strand_N
uuuacguugcgcacggc
................]
>strand_R
ACACGGCGAa
...)))))))