You are 4700899 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1SZY 1SZY A1RNANMR2004-04-06


model 1
>strand_A
GGCAGGGCUCAUAACCCUGCC
(((((((.......)))))))