You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1ZRF PD0673 W, X, Y, Z, A, B1GENE REGULATION/DNAX-Ray Difraction2.12005-05-19


model 1
>strand_W
auuucgaaaaaugcgau
--.((((((((((((((
>strand_X
cuagaucgcauuuuucgaaau
[[[[))))))))))))))...
>strand_Y
auuucgaaaaaugcgau
-((((((((((((((((
>strand_Z
cuagaucgcauuuuucgaaau
]]]])))))))))))))))).
>strand_A
nnnnnnaa
------..
>strand_B
nnnnnnnnnaa
---------..