You are 4700899 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2AZX PR0176 C, D1LIGASE/RNAX-Ray Difraction2.82005-09-12


model 1
>strand_C
GACCUCGUGGCGCAAUGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCGAAUCACGUCGGGGUCACCA
(((((((..((((.......)))).(((((.......))))).....(((((.......)))))))))))).---
>strand_D
GACCUCGUGGCGCAAUGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCGAAUCACGUCGGGGUCACCA
...((((..((((....[..)))).(((((.......))))).....(((((..]....)))))))))....---