Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700900
visitor.
Currently
9
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
2B2D
PR0177
R, S
1
VIRUS/VIRAL PROTEIN/RNA
X-Ray Difraction
2.9
2005-09-19
model 1
>strand_R
AUGCAUgUCUAAGACAGCAU
------(((...)))-----
>strand_S
AUGCAUGUCUAAGACAGCAU
----------...-------