Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700900
visitor.
Currently
9
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
2CKY
2CKY
A, B
1
NUCLEIC ACID
X-Ray Difraction
2.9
2006-04-24
model 1
>strand_A
gGGACCAGGGGUGCUUGUUCACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUC
..((((((((..(((((....))))).........)))).....(((...((((......))))...)))..).)))
>strand_B
GGGACCAGGGGUGCUUGUUCACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUC
..((((((((..(((((....))))).........)))).....(((....(((......)))....)))..).)))