You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2DET PR0193 C1TRANSFERASE/RNAX-Ray Difraction3.42006-02-17


model 1
>strand_C
GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUUCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGCCA
...(.....((((.........)))).(((((.......)))))......(((.......)))....)..------