Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700899
visitor.
Currently
10
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
2Q2U
PD1018
E, F, G, H, I, J, K, L
1
LIGASE/DNA
X-Ray Difraction
3
2007-05-29
model 1
>strand_E
uuccgauaguggggucgcaau
(((((((((((((((((((((
>strand_F
auugcgaccccacuaucggaa
)))))))))))))))))))))
>strand_G
uuccgauaguggggucgcaau
(((((((((((((((((((((
>strand_H
auugcgaccccacuaucggaa
)))))))))))))))))))))
>strand_I
uuccgauaguggggucgcaau
(((((((((((((((((((((
>strand_J
auugcgaccccacuaucggaa
)))))))))))))))))))))
>strand_K
uuccgauaguggggucgcaau
(((((((((((((((((((((
>strand_L
auugcgaccccacuaucggaa
)))))))))))))))))))))