Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700898
visitor.
Currently
10
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
2TPK
2TPK
A
1
RNA
NMR
1998-10-28
model 1
>strand_A
GCUGACCAGCUAUGAGGUCAUACAUCGUCAUAGCAC
..[[[[[.(((((((]]]]].......)))))))..