You are 4700902 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2VUM 2VUM N, P, T1TRANSFERASEX-Ray Difraction3.42008-05-27


model 1
>strand_N
aaacuacuugagcu
-.(..(((((((((
>strand_P
AaAGACCAGGC
-..[[[[[[[[
>strand_T
agcucaaguaguuacgccuggucauu
)))))))))..)...]]]]]]]]..-