Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700898
visitor.
Currently
10
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
2WW9
D, E, F, G
1
RIBOSOME
Electron Microscopy
8.6
2009-10-22
model 1
>strand_D
aGAACGCAGCGAAAUGCGAUACGUAAUGUGAAUUGCAGAAUUCCGUGAAUCAUCGAAUCUUUG
.((((............).....(.((....(((....)))..........))..)...))).
>strand_E
UGAAAAGAACUUUGAAAAGAGAGUGAAAAAGUAC
......(..((((....))))............)
>strand_F
CCACGUCAACAGCAGUUGGACGUGG
((((((...((.....)).))))))
>strand_G
GCCAGCACCUUUGCUGGC
(((((((....)))))))