Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700900
visitor.
Currently
9
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
2ZNI
PR0343
C, D
1
LIGASE/RNA
X-Ray Difraction
3.1
2008-04-25
model 1
>strand_C
GGGGGGUGGAUCGAAUAGAUCACACGGACUCUAAAUUCGUGCAGGCGGGUGAAACUCCCGUACUCCCCGCCA
(((((((.((((.....)))).(.((((.......)))).)...(((((.......))))))))))))....
>strand_D
GGGGGGUGGAUCGAAUAGAUCACACGGACUCUAAAUUCGUGCAGGCGGGUGAAACUCCCGUACUCCCCGCCA
(((((((.((((...[.)))).(((((.........)))))...(((((..]....))))))))))))....