You are 4700898 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2ZUE PR0357 B1LIGASE/RNAX-Ray Difraction22008-10-16


model 1
>strand_B
GGACCGGUAGCCUAGCCAGGACAGGGCGGCGGCCUCCUAAGCCGCAGGUCCGGGGUUCAAAUCCCCGCCGGUCCGCCA
(((((((..((((..........)))).(((((.......))))).....(((((.......))))))))))))..--