You are 4700899 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3BO1 D, E, F, G1RIBOSOMEElectron Microscopy9.62007-12-15


model 1
>strand_D
cGGUAAGGUGAUAUGAACCGUUAUAAC
..(...(((.......))).......)
>strand_E
AAAGAACCCCGGCGAGGGGAGUGAAAA
......((((.....))))........
>strand_F
ACAGGUUAAUAUUCCUGUA
(((((........))))).
>strand_G
CGUGAUGACGAGGCACUACGGUGCUGAAGCAA
........(..(((((....)))))...)...