Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700900
visitor.
Currently
9
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
3F73
PH0052
C, H, X, Y
1
NUCLEIC ACID BINDING PROTEIN/DNA/RNA
X-Ray Difraction
3
2008-11-07
model 1
>strand_C
ugagguaguauuguaagu
.((((((((.-----...
>strand_H
UAUACAAACUACCUCU
-------))))))))-
>strand_X
ugagguaguagguuguuagu
.((((((((.------....
>strand_Y
UAUACAACACUACCUCU
--------))))))))-