You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3HJF NA0005 X, Y1NUCLEIC ACID BINDING PROTEIN/DNA/RNAX-Ray Difraction3.062009-05-21


model 1
>strand_X
ugagguaguagguuguuagu
.((((((((((((((.----
>strand_Y
cAACCUACUACCUC
))))))))))))))