You are 4700898 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3HOW NA0032 2, 1, 31TRANSCRIPTION,TRANSFERASE/DNA/RNA HYBRIDX-Ray Difraction3.62009-06-03


model 1
>strand_2
acuacuugagcu
(((((((-----
>strand_1
agcucaaguaguuaugccuggucauu
-----)))))))...(((((((..--
>strand_3
UGCAUUUcAACCAGGCUU
-------..)))))))..