You are 4700902 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3I4M NA0061 T, N, P1TRANSCRIPTION,TRANSFERASE/DNA-RNA HYBRIDX-Ray Difraction3.72009-07-02


model 1
>strand_T
agcucaaguacuuaggccuggucauu
--((((((((((..[[[[[[[..---
>strand_N
aguacuugagcu
)))))))))).-
>strand_P
UGCAUCuUCCAGGCCU
------..]]]]]]].