You are 4700899 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3IQP NA0126 A1RNAX-Ray Difraction2.92009-08-20


model 1
>strand_A
GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCG
((((((((....(.(((...(((.[.[[)))......))))(((.((((....)))))))...(]].](((((....)))))..))))))))).