Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700899
visitor.
Currently
10
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
3NVK
NA1166
K, G, L, S
1
TRANSFERASE/RNA
X-Ray Difraction
3.21
2010-07-08
model 1
>strand_K
GCCGUUGAaGCUCUGACCGAAAGGCGUGAUGAGC
--------..(.....................--
>strand_G
GAGCUUCAACGGC
--)..--------
>strand_L
GCCGUUGAAGCUCUGACCGAAAGGCGUGAUGAGC
--------..(.....................--
>strand_S
GAGCUUCAACGGC
--)..--------