You are 4700898 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3PO2 NA0842 N, P, T1TRANSFERASE/DNA/RNAX-Ray Difraction3.32010-11-21


model 1
>strand_N
aagguaagcuagcu
.(((((.((.((..
>strand_P
CCCCCCCCCCCCCCC
..[.[[.........
>strand_T
agcuagcuuaccugguguugcucuaac
..)).)).)))))]].]..--------