You are 4700902 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3PO3 NA0884 N, P, T1TRANSFERASE/DNA/RNAX-Ray Difraction3.32010-11-21


model 1
>strand_N
gagguaagcuagcu
--(((..((-----
>strand_P
CCCCC
[.[[.
>strand_T
agcuagcuuaccugguguugcucuaac
-----))..))).]].].---------