You are 4700898 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3RZO NA1120 R, T1TRANSCRIPTION/RNA/DNAX-Ray Difraction32011-05-12


model 1
>strand_R
gAGG
(.((
>strand_T
cuaccgauaagcagacgauccucucgaug
---------------...)).).------