You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3S15 NA1117 R, T1TRANSCRIPTION/RNA/DNAX-Ray Difraction3.32011-05-14


model 1
>strand_R
cGAGAGG
(((((((
>strand_T
cuaccgauaagcagacgauccucucgaug
---------------....)))))))..-