You are 4700898 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3VJR NA1381 B, D1HYDROLASE/RNAX-Ray Difraction2.42011-10-28


model 1
>strand_B
GGGGGCUAAGCGGUUCGAUCCCGCUUAGCUCCACCA
.((((((((((((.......))))))))))))....
>strand_D
GGGGGCUAAGCGGUUCGAUCCCGCUUAGCUCCACCA
.((((((((((((.......))))))))))))....