You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4A3K NA1414 N, P, T1TRANSCRIPTIONX-Ray Difraction3.52011-09-30


model 1
>strand_N
uaaguacuuga
-.(((((((..
>strand_P
ACCAGGA
[[[[[[[
>strand_T
agcucaaguacuuuuuccuggucauu
---..)))))))...]]]]]]]----