You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4B3Q NA2192 D, R1HYDROLASE/DNA/RNAX-Ray Difraction52012-07-25


model 1
>strand_D
ucguaugccuauaguuauuguggcc
----(((((((((((((((((((((
>strand_R
AUGAnGGCCACAAUAACUAUAGGCAUACGACCAC
-----)))))))))))))))))))))--------