You are 4700899 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4BXX NA2665 N, P, T1TRANSCRIPTIONX-Ray Difraction3.282013-07-16


model 1
>strand_N
gagguaagcuagcu
-((((((((..---
>strand_P
CCCCCCCCCCC
[..[.......
>strand_T
agcuagcuuaccugguguugcucuaac
----.))))))))]..].---------