You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4C4W NA2909 D, H1RNA BINDING PROTEIN/RNAX-Ray Difraction2.952013-09-09


model 1
>strand_D
gAGCAAGAGCCAUUGCACUCCGGUUUGAUGACCUC
(((...(((((..........)))))......)))
>strand_H
GAGCAAGAGCCAUUGCACUCCGGUUUGAUGACCUC
(((...(((((..........)))))......)))