You are 4700902 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4F8V NA1818 A, B1RNA/ANTIBIOTICX-Ray Difraction2.82012-05-18


model 1
>strand_A
GCGUCACACCGGUGAAGUCGC
(((.(.((((((((..(.(((
>strand_B
GCGUCACACCGGUGAAGUCGC
))).).))))))))..).)))