You are 4700902 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4GZY NA2034 N, R, T1TRANSCRIPTION/DNA/RNAX-Ray Difraction3.512012-09-06


model 1
>strand_N
ggaagagauuccc
--(((((((((((
>strand_R
CCUGACUAGUCUUUCAGGUAAUGUGUGCU
--------------------[[[[[[[.[
>strand_T
gggaaucucuuccagcacacau
)))))))))))..].]]]]]]]