You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4K4Y NA2352 B, C, D, F, G, H, J, K, L, N, O, P1TRANSFERASE/RNAX-Ray Difraction2.722013-04-12


model 1
>strand_B
AAGUcUCCAGGUCUCUCGUCGAAA
----(.((..((((((((((((--
>strand_C
UGUUCGACGAGAGAc
---))))))))))))
>strand_D
GGGAGAUGA
-)).).---
>strand_F
AAGUCUCCAGGUCUCUCGUCGAAA
-----(((..((((((((((((--
>strand_G
UGUUCGACGAGAGAc
---))))))))))))
>strand_H
GGGAGAUGA
-)))..---
>strand_J
AAGUCUCCAGGUCUCUCGUCGAAA
----((((..((((((((((((--
>strand_K
UGUUCGACGAGAGAc
---))))))))))))
>strand_L
GGGAGAUGA
-)))).---
>strand_N
AAGUCUCCAGGUCUCUCGUCGAAA
-----(((..((((((((((((--
>strand_O
UGUUCGACGAGAGAc
---))))))))))))
>strand_P
GGGAGAUGA
-)))..---