Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700900
visitor.
Currently
9
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
4K4Y
NA2352
B, C, D, F, G, H, J, K, L, N, O, P
1
TRANSFERASE/RNA
X-Ray Difraction
2.72
2013-04-12
model 1
>strand_B
AAGUcUCCAGGUCUCUCGUCGAAA
----(.((..((((((((((((--
>strand_C
UGUUCGACGAGAGAc
---))))))))))))
>strand_D
GGGAGAUGA
-)).).---
>strand_F
AAGUCUCCAGGUCUCUCGUCGAAA
-----(((..((((((((((((--
>strand_G
UGUUCGACGAGAGAc
---))))))))))))
>strand_H
GGGAGAUGA
-)))..---
>strand_J
AAGUCUCCAGGUCUCUCGUCGAAA
----((((..((((((((((((--
>strand_K
UGUUCGACGAGAGAc
---))))))))))))
>strand_L
GGGAGAUGA
-)))).---
>strand_N
AAGUCUCCAGGUCUCUCGUCGAAA
-----(((..((((((((((((--
>strand_O
UGUUCGACGAGAGAc
---))))))))))))
>strand_P
GGGAGAUGA
-)))..---