Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700900
visitor.
Currently
9
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
4K50
NA2354
B, C, F, G, J, K, N, O
1
TRANSFERASE/RNA
X-Ray Difraction
2.93
2013-04-12
model 1
>strand_B
aGGAGAUGAAAGUCUCCAGGUCUCUCGUCCGGAA
.((((((....))))))...((((((((((((--
>strand_C
GCCCGGACGAGAGA
[[))))))))))))
>strand_F
AGGAGAUGAAAGUCUCCAGGUCUCUCGUCCGGAAA
-((((((....))))))...((((((((((((---
>strand_G
GCCCGGACGAGAGA
]]))))))))))))
>strand_J
AGGAGAUGAAAGUCUCCAGGUCUCUCGUCCGGAA
.((((((....))))))...((((((((((((--
>strand_K
GCCCGGACGAGAGA
[[))))))))))))
>strand_N
AGGAGAUGAAAGUCUCCAGGUCUCUCGUCCGGAA
-((((((....))))))...((((((((((((--
>strand_O
GCCCGGACGAGAGA
]]))))))))))))