You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4QYZ NA3085 L, M1IMMUNE SYSTEM/DNA/RNAX-Ray Difraction3.032014-07-26


model 1
>strand_L
aUAAACCGCCAGUGAUAAGUGGAAUGCCAUGUGGGCUGUCGAGUUCCCGGCGCCAGCCGGG
........((.((..(..(.((..(..(.((.(((((.((.......(((------)))..
>strand_M
aaucagacagcccacauggcauuccacuuaucacuggcau
---.)).))))).)))..))).)).))))--.........