You are 4700898 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4UN3 NA3068 A, C, D1HYDROLASE/DNA/RNAX-Ray Difraction2.592014-05-25


model 1
>strand_A
GGaUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG
--.(..(((..(((((......((((((..((((....))))....))))))..(((..).)).......((((....)))).
>strand_C
caauaccauuuuuuacaaauugaguuau
[...[[.)))))))))-...]].]....
>strand_D
aaaaugguauug
............