Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700900
visitor.
Currently
9
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
4WQS
G, H, I, X, Y, Z
1
TRANSFERASE/DNA/RNA
X-Ray Difraction
4.31
2014-10-22
model 1
>strand_G
gucacuaccacaagcuacgcgagcgccg
-(.(.((.(..((.(((((((((((...
>strand_H
CCAGCCGGCGCUCGCA
..)))))))))).).)
>strand_I
guagcuugugguagugacgag
)))).)).-----(.(.((.(
>strand_X
gucacuaccacaagcuacgcgagcgccg
..((.(((((((((((.....)))))))
>strand_Y
CCAGCCGGCGCUCGCA
)))-).))))).)).-
>strand_Z
guagcuugugguagugacgag
---..................