You are 4700899 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4X4O B, D1RNA BINDING PROTEINX-Ray Difraction3.22014-12-03


model 1
>strand_B
gGCCGCGGCAGGUUCGAAUCCUGCCGCGAUCGCC
((((((((((((.......)))))))))...)))
>strand_D
GGCCGCGGCAGGUUCGAAUCCUGCCGCGAUCGCC
((((((((((((.......)))))))))...)))