You are 4700902 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
4X6A R, T1TRANSCRIPTION/DNAX-Ray Difraction3.962014-12-07


model 1
>strand_R
aUCGAGAGU
.(.(.(.(.
>strand_T
cuaccgauaagcagaggcaacucucgaug
----------------.))).).......