You are 4700899 visitor.
Currently 10 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
5A17 5A17 A10RNANMR2015-04-28



models:   1   2   3   4   5   6   7   8   9   10

 model 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 
>strand_A
GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC
((((((((((..(.....)..)).))))))))